Review





Similar Products

35 mer oligonucleotide tet cccagtcacgacgttgtaaaacgacggccagtgcc  (New England Biolabs)
96
New England Biolabs 35 mer oligonucleotide tet cccagtcacgacgttgtaaaacgacggccagtgcc
Denaturing PAGE (8%) showing the impact of absence/presence of PCNA on processive leading strand synthesis by wild type Pol ε and its variants. Extension of a 5′-TET-labeled <t>35–mer</t> oligo annealed to M13mp18ssDNA (NEB). Reactions were performed at 40-fold molar excess of DNA substrate over polymerase to meet single-hit criteria. Individual reactions were stopped at 0, 2, 5, and 15 min, respectively.
35 Mer Oligonucleotide Tet Cccagtcacgacgttgtaaaacgacggccagtgcc, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oligonucleotide+strands/pmc13036494-47-16-12?v=New+England+Biolabs
Average 96 stars, based on 1 article reviews
35 mer oligonucleotide tet cccagtcacgacgttgtaaaacgacggccagtgcc - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier
oligonucleotide strand  (Sangon Biotech)
86
Sangon Biotech oligonucleotide strand
Denaturing PAGE (8%) showing the impact of absence/presence of PCNA on processive leading strand synthesis by wild type Pol ε and its variants. Extension of a 5′-TET-labeled <t>35–mer</t> oligo annealed to M13mp18ssDNA (NEB). Reactions were performed at 40-fold molar excess of DNA substrate over polymerase to meet single-hit criteria. Individual reactions were stopped at 0, 2, 5, and 15 min, respectively.
Oligonucleotide Strand, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oligonucleotide+strands/pmc13191104-267-5-74?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
oligonucleotide strand - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier
single strand sgrna oligonucleotides  (Sangon Biotech)
86
Sangon Biotech single strand sgrna oligonucleotides
Denaturing PAGE (8%) showing the impact of absence/presence of PCNA on processive leading strand synthesis by wild type Pol ε and its variants. Extension of a 5′-TET-labeled <t>35–mer</t> oligo annealed to M13mp18ssDNA (NEB). Reactions were performed at 40-fold molar excess of DNA substrate over polymerase to meet single-hit criteria. Individual reactions were stopped at 0, 2, 5, and 15 min, respectively.
Single Strand Sgrna Oligonucleotides, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oligonucleotide+strands/pm42161958-259-0-5?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
single strand sgrna oligonucleotides - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier
106mer single stranded oligonucleotides  (Twist Bioscience)
86
Twist Bioscience 106mer single stranded oligonucleotides
Denaturing PAGE (8%) showing the impact of absence/presence of PCNA on processive leading strand synthesis by wild type Pol ε and its variants. Extension of a 5′-TET-labeled <t>35–mer</t> oligo annealed to M13mp18ssDNA (NEB). Reactions were performed at 40-fold molar excess of DNA substrate over polymerase to meet single-hit criteria. Individual reactions were stopped at 0, 2, 5, and 15 min, respectively.
106mer Single Stranded Oligonucleotides, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oligonucleotide+strands/pm42155443-294-16-19?v=Twist+Bioscience
Average 86 stars, based on 1 article reviews
106mer single stranded oligonucleotides - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier
stranded oligonucleotide hot probes  (Sangon Biotech)
86
Sangon Biotech stranded oligonucleotide hot probes
Denaturing PAGE (8%) showing the impact of absence/presence of PCNA on processive leading strand synthesis by wild type Pol ε and its variants. Extension of a 5′-TET-labeled <t>35–mer</t> oligo annealed to M13mp18ssDNA (NEB). Reactions were performed at 40-fold molar excess of DNA substrate over polymerase to meet single-hit criteria. Individual reactions were stopped at 0, 2, 5, and 15 min, respectively.
Stranded Oligonucleotide Hot Probes, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oligonucleotide+strands/pmc13193528-133-1-14?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
stranded oligonucleotide hot probes - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier
double stranded dna oligonucleotide  (Macrogen)
86
Macrogen double stranded dna oligonucleotide
Denaturing PAGE (8%) showing the impact of absence/presence of PCNA on processive leading strand synthesis by wild type Pol ε and its variants. Extension of a 5′-TET-labeled <t>35–mer</t> oligo annealed to M13mp18ssDNA (NEB). Reactions were performed at 40-fold molar excess of DNA substrate over polymerase to meet single-hit criteria. Individual reactions were stopped at 0, 2, 5, and 15 min, respectively.
Double Stranded Dna Oligonucleotide, supplied by Macrogen, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oligonucleotide+strands/pm41916519-142-0-14?v=Macrogen
Average 86 stars, based on 1 article reviews
double stranded dna oligonucleotide - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier
synthetic single stranded oligonucleotides  (Sangon Biotech)
86
Sangon Biotech synthetic single stranded oligonucleotides
Denaturing PAGE (8%) showing the impact of absence/presence of PCNA on processive leading strand synthesis by wild type Pol ε and its variants. Extension of a 5′-TET-labeled <t>35–mer</t> oligo annealed to M13mp18ssDNA (NEB). Reactions were performed at 40-fold molar excess of DNA substrate over polymerase to meet single-hit criteria. Individual reactions were stopped at 0, 2, 5, and 15 min, respectively.
Synthetic Single Stranded Oligonucleotides, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oligonucleotide+strands/pmc13130770-31-6-10?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
synthetic single stranded oligonucleotides - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier
150 nt single stranded oligonucleotide donor ssodn template  (Azenta)
86
Azenta 150 nt single stranded oligonucleotide donor ssodn template
Denaturing PAGE (8%) showing the impact of absence/presence of PCNA on processive leading strand synthesis by wild type Pol ε and its variants. Extension of a 5′-TET-labeled <t>35–mer</t> oligo annealed to M13mp18ssDNA (NEB). Reactions were performed at 40-fold molar excess of DNA substrate over polymerase to meet single-hit criteria. Individual reactions were stopped at 0, 2, 5, and 15 min, respectively.
150 Nt Single Stranded Oligonucleotide Donor Ssodn Template, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oligonucleotide+strands/pmc12974472-244-7-14?v=Azenta
Average 86 stars, based on 1 article reviews
150 nt single stranded oligonucleotide donor ssodn template - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier
single stranded oligonucleotide donors ssodns  (Benchling Inc)
86
Benchling Inc single stranded oligonucleotide donors ssodns
Denaturing PAGE (8%) showing the impact of absence/presence of PCNA on processive leading strand synthesis by wild type Pol ε and its variants. Extension of a 5′-TET-labeled <t>35–mer</t> oligo annealed to M13mp18ssDNA (NEB). Reactions were performed at 40-fold molar excess of DNA substrate over polymerase to meet single-hit criteria. Individual reactions were stopped at 0, 2, 5, and 15 min, respectively.
Single Stranded Oligonucleotide Donors Ssodns, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oligonucleotide+strands/pmc12920786-199-0-9?v=Benchling+Inc
Average 86 stars, based on 1 article reviews
single stranded oligonucleotide donors ssodns - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

Image Search Results


Denaturing PAGE (8%) showing the impact of absence/presence of PCNA on processive leading strand synthesis by wild type Pol ε and its variants. Extension of a 5′-TET-labeled 35–mer oligo annealed to M13mp18ssDNA (NEB). Reactions were performed at 40-fold molar excess of DNA substrate over polymerase to meet single-hit criteria. Individual reactions were stopped at 0, 2, 5, and 15 min, respectively.

Journal: Nucleic Acids Research

Article Title: A thumb-domain insertion balances processivity and fidelity in DNA polymerase ε

doi: 10.1093/nar/gkag282

Figure Lengend Snippet: Denaturing PAGE (8%) showing the impact of absence/presence of PCNA on processive leading strand synthesis by wild type Pol ε and its variants. Extension of a 5′-TET-labeled 35–mer oligo annealed to M13mp18ssDNA (NEB). Reactions were performed at 40-fold molar excess of DNA substrate over polymerase to meet single-hit criteria. Individual reactions were stopped at 0, 2, 5, and 15 min, respectively.

Article Snippet: The substrate for processivity assays was prepared by annealing M13mp18 single-stranded DNA (NEB) with a 5′-TET–labeled 35-mer oligonucleotide (TET-CCCAGTCACGACGTTGTAAAACGACGGCCAGTGCC) in equimolar amounts in 125 mM NaAc (pH 7.8).

Techniques: Labeling